2017.02.04.6 - Revista bionatura

Bionatura
Bionatura
Go to content

Main menu:

2017.02.04.6

Número > Actual

INVESTIGATION / RESEARCHS
Previos / Index / Next

Contaminación por metales pesados en el sur del Ecuador asociada a la actividad minera.
Contamination by heavy metals in the south of Ecuador associated to the mining activity.

Rodrigo Oviedo-Anchundia1, Emy Moína-Quimí 1, Jaime Naranjo-Morán1, Milton Barcos-Arias1

http://dx.doi.org/10.21931/RB/2017.02.04.6

 
_______________________________________________________________________________________________________________________
 
 
RESUMEN   
                                                                                                 
 
La fijación biológica del Nitrógeno es un proceso que aporta con un 65% de fijación anual de nitrógeno al ecosistema; ejecutada por microorganismos fúngicos capaces de reducir la forma atmosférica del N en una forma asimilable. Existen varias actividades antrópicas que han favorecido el aumento de la adicción de N, lo que ha generado la duplicación de la cantidad que es incorporada por año en los diferentes ciclos biológicos de la tierra. El presente estudio tiene como objetivo caracterizar molecularmente y criopreservar hongos asociados con la respuesta al estrés por N. Se seleccionaron suelos sometidos a un alto estrés por adicción sostenida de N junto a suelos control, de los cuales se aisló los hongos cultivables para ser caracterizados y clasificados morfológicamente a través de técnicas moleculares. Obteniendo como resultado 43 cepas caracterizadas por morfología básica (color, forma y tamaño). Por medio de la secuencia del gen ITS ARN ribosomal, la filogenia indicó la presencia del Phylum Ascomycota con dos clados: Eurotiales con los siguientes géneros (Penicillium, Citrinum, y Aspergillus). El clado Hypocreales presenta los géneros (Metarrhzium, Clonostachys y Tolypocladium) y el Phylum Zygomycota con el género Morlierella. El porcentaje de reactivación de las cepas criopreservadas fue de 98%.

 
Palabras Clave: Caracterización molecular, hongos cultivables, ITS ARN ribosomal Ascomycota, Zygomycota, criopreservación.
 
_______________________________________________________________________________________________________________________

ABSTRACT
 
Biological nitrogen fixation is a process that provides a 65% anual nitrogen fixation ecosystem; executed by fungal microorganisms capable of reducing atmospheric form of N in an assimilable form. There are several human activities that have favored increasing addiction of N, which has led to the doubling of the amount of N that is incorporated by year in the different life cycles of the soil. This study aims to characterize molecularly and cryopreserved fungi associated with the stress response of N, soils subjected to high stress addiction sustained N with soil control, which cultivable fungi was isolated to be characterized and classified were selected morphologically through molecular techniques. Which resulted in 43 strains characterized by basic morphology (color, shape and size). By means of the sequence of the ribosomal ITS RNA gene, phylogeny indicated the presence of the phylum Ascomycota two clades. Eurotiales with the following genres (Penicillium, Citrinum, and Aspergillus). The Hypocreales clade presents the genera (Metarrhzium, Clonostachys and Tolypocladium) and Phylum Zygomycota with the genus Morlierella. The reactivation rate of the cryopreserved strains was 98%. 
 Keywords: Molecular characterization, cultivable fungi, ITS ribosomal RNA, Ascomycota, Zygomycota, cryopreservation.
 
_______________________________________________________________________________________________________________________
 
 
INTRODUCCIÓN

 
Los bosques montanos tropicales son ecosistemas con un alto grado de diversidad biológica, pero se encuentran altamente amenazados por su vulnerabilidad ante los cambios globales como el cambio climático y mal uso de los suelos(1). Aparte de su gran diversidad biológica, estos ecosistemas favorecen el desarrollo de microorganismos del suelo debido a la gran cantidad de variaciones ambientales(2). En las últimas décadas la deposición atmosférica ha aumentado notablemente por fuentes antropogénicas(3), debido a la industrialización, el uso de productos químicos y fertilizantes, o a la quema de biomasa(4). Actualmente los suelos tropicales aportan con el 30% de las emisiones globales de N2O, que es uno de los principales gases de invernadero(5). Como resultado  se evidencia un alto nivel de N en los suelos tropicales, modificaciones en la biota y aceleración del ciclo de descomposición y fijación de N en estos ecosistemas(5).
 
La adición de N afecta todos los procesos en el suelo, especialmente a los procesos biológicos(6), dichos procesos son desarrollados por microorganismos (bacterias y hongos) que se encuentran asociados al suelo(7). Sus funciones en el ecosistema son de vital importancia para procesos bioquímicos y procesos de degradación(8). Dentro de las comunidades microbianas, las comunidades fúngicas son de gran interés, porque funcionan como un indicador de salud en un ecosistema. Una gran diversidad de hongos indica la capacidad de los ecosistemas para recuperarse ante daños ambientales (p.ej. adición excesiva de N); además, las comunidades fúngicas juegan un papel importante en la degradación de la materia orgánica y en el ciclo natural del N(7). Por ello representan la mayor parte de la biomasa microbiana en los suelos(9).
 
El objetivo de este estudio es caracterizar la morfología básica y molecular de la diversidad de hongos de un suelo de bosque montano tropical en el sur del Ecuador. Los bosques montanos de esta región representan el 11% de los bosques montanos tropicales del mundo(5), pero sus suelos son altamente afectados por la adición excesiva de N. Además, el presente trabajo analiza el impacto potencial asociado a la adición sostenida de N y la conservación de los hongos aislados mediante el método de criopreservación.

 
MATERIALES Y MÉTODOS

 
Área de estudio
 
El muestreo se realizó en la Reserva Biológica San Francisco (RBSF), ubicada a 30 km de la ciudad de Loja, en la provincia de Zamora Chinchipe dentro del Parque Nacional Podocarpus(10). El  muestreo de campo se realizó en el sector T1 específicamente en el transecto preestablecido NUMEX(11). El transecto NUMEX presenta diferentes niveles de adición de minerales, del cual se seleccionó el bloque 1 y 2.  Cada bloque contiene dos parcelas la primera con suelos control (suelos sin tratamiento de adicción de N) y la segunda con adición de N sostenido por nueve años consecutivos. Dando como resultado 4 parcelas muestreadas por los dos bloques seleccionados.
 

Toma de muestras y aislamiento in vitro.
 
De cada parcela se extrajo cinco muestras de suelo a una profundidad de 30 cm. Las muestras de suelo se preservaron a -20°C. El aislamiento de los hongos se hizo por el método de diluciones seriadas a partir de suelo de muestra homogenizado. Y se procedió a cultivarlas en cajas Petri con medio de cultivo Rosa Bengala.
 
El conteo de colonias se realizó cada 2 días para obtener las unidades formadoras de colonia. Finalmente se realizó el conteo de las colonias fúngicas tomando en consideración la morfología básica de las colonias como: el color, tamaño, y la forma de crecimiento de la colonia.
   

Criopreservación de hongos
 
El proceso de criopreservación se realizó en una relación 70:30 de Potato Dextrose Agar (PDA) y glicerina, criopreservados a una T° de -4°C. Posteriormente fueron reactivados para medir la viabilidad de las cepas.
 

Caracterización molecular
 
Se extrajo el ADN de las muestras de hongos por medio del kit de extracción UltraClean Microbial DNA Insolation Kit MoBio, el mismo que nos permitió obtener ADN genómico con alta calidad (30). Se cuantificó la calidad del ADN empleando el NanoDrop 2000 - Thermo Scientific.
 

Reacción en Cadena de la Polimerasa - PCR.
 
Las PCR se realizaron con ayuda del termociclador (Pro Flex), las condiciones aplicadas fueron: 95°C-2min por 1 ciclo; 95°C-1min, 50°C-30seg, 72°C-30seg por 40 ciclos; 72°C-5min por 1 ciclo. Los primers utilizados poseen las siguientes secuencias: ITS 1f: CTTGGTCATTTAGAGGAAGTAA(12), ITS 5.8S: GGAAGTAAAAGTCGTAACAAGG (13).
 
Finalmente se procedió a la verificación de los productos de PCR por medio de la electroforesis en un gel de agarosa al 1%.
 

Análisis de datos.
 
Las muestras fueron secuenciadas en la compañía MACROGEN (Korea). Las secuencias obtenidas fueron comparadas con secuencias del GenBank, por medio de la utilización de la herramienta BLASTn; las secuencias homólogas seleccionadas de este programa nos sirvieron para brindar soporte a los resultados obtenidos. Esto permitió asignar un género a cada una de las secuencias, tomando en cuenta el mejor hit. Con la ayuda del programa MEGA6 y de un análisis Maximun Likelihood, se obtuvo el árbol filogenético de las secuencias analizados.

 
RESULTADOS Y DISCUSIÓN

 
Caracterización Morfológica básica de los hongos cultivables del suelo.
 
De los resultados del aislamiento y posterior identificación de los aislados puros, se logró obtener un total de 43 aislados de ambos bloques que representan a los hongos cultivables del suelo Tabla 1.

 
Tabla 1: Caracterización morfológica de hongos cultivables del suelo

 
Con la metodología aplicada no fue posible obtener un 100% de aislados del suelo; existen varias razones para justificar este hecho. Principalmente se toma en cuenta la distribución, debido a que estos no se encuentran distribuidos de manera  uniforme en el suelo(14). La selección del medio es un factor muy importante al momento de incrementar el porcentaje obtenido de hongos cultivables del suelo, debido a que los nutrientes que contiene el medio favorecen el crecimiento del material fúngico. Cabe recalcar que la presencia del Clorofenicol en el medio Rosa Bengala asegura que no exista crecimiento de bacterias en los cultivos (31). A pesar de las limitaciones que la metodología presenta, los resultados obtenidos generan un aporte de conocimiento científico sobre la composición fúngica de los suelos con adición de N.

 
Criopreservación
 
La utilización de la combinación del medio PDA más la adición de glicerina en una relación 70:30 respectivamente, permitió obtener el resultado deseado en la criopreservación de los aislados. De los 43 morfotipos aislados e identificados se realizó la criopreservación, con un 98% de éxito en la reactivación de material Tabla 2. Se sabe que los tiempos de conservación de material fúngico en criopreservación son críticos para la supervivencia celular(15). Se ha comprobado que el mejor crioprotectante para la criopreservación de hongos es la glicerina(16). Debido a que previene la acumulación de agua y la formación de cristales que pueden romper la membrana celular, gracias a su bajo peso molecular(15).


 
Tabla 2: Reactivación de Muestras Criopreservadas

 
Análisis Filogenético
 
El material genético proporcionado por las 43 muestras aisladas fue obtenido a partir de la secuención la región ITS 1, de acuerdo a los resultados obtenidos podemos identificar la presencia de dos Phylum: Ascomycota y Zygomycota, dentro del Phylum Ascomycota se encuentran dos clados, Eurotiales y Hypocreales; dentro de Eurotiales se obtuvo los siguientes géneros Penicillium, Citrinum, y Aspergillus. El clado Hypocreales presenta los géneros Metarrhzium, Clonostachys y Tolypocladium. En el filum Zygomycota se obtuvo el género Morlierella (Tabla 3). En la figura 1 se muestra el árbol filogenetico, obtenido con el metodo maximun likelihood, en el que se incluyen las 43 secuencias pertenecientes a los aislados puros obtenidos en este estudio.

 
Tabla 3: Cuadro de asignación de género mediante búsqueda por homología (BLAST) a cada uno de los aislados puros. Se detalla además el origen de cada aislado (bloques y tratamientos).

 
Los géneros Penicillium, Citrinum y Aspergillus son capaces de adaptarse a la variación de disponibilidad de nutrientes(17). Existen varios estudios realizados en donde se ha encontrado que estos géneros pueden desarrollarse en suelos que han sido sometidos a diferentes tipos de estrés, en nuestro caso la adición sostenida de N(18).   

 
Figura 1: Árbol filogenético de la región ITS 1 obtenida de los aislados. El árbol presenta los géneros que se obtuvieron de la RBSF.; fue soportado con secuencias obtenidas del GenBank https://www.ncbi.nlm.nih.gov/genbank/.

 
La presencia de Penicillium cf. Citrinum tanto en las parcelas con N como en las parcelas control se debe a que esta especie es capaz de crecer en medios que se encuentran alterados, como se ha demostrado en el estudio publicado por (20). De la misma manera el género Aspergillius es versátil al momento de adaptar su metabolismo para utilizar una amplia cantidad de N en los suelos(21).
 
Los géneros Metarrhzium y Tolypocladium fueron hallados en ambos bloques, pero solo en suelos con adición de N. Las especies de estos géneros  actúan como entomopatogenos (parásitos de insectos), endófitos y saprofitos, además pueden llegar a ser tóxicos(22). La relación C:N que mantienen los géneros Metarrhzium y Tolypocladium con el suelo ocasiona un efecto positivo en el aumento de la funcionalidad, demostrado en el incremento de la biomasa fúngica y en la degradación e inmovilización del N, que en presencia de altos niveles de N en el suelo las especies de estos géneros modifican sus estructuras para elevar su potencial de resistencia a la desecación y a su vez aumenta la producción de microsclerotia (estructuras que ayudan a la fijación de conideas)(23). De esta forma estos hongos reducen la demanda de oxígeno y favorecen la inmovilización de nitrógeno en el suelo(24). Por otro lado se encuentran beneficiados ya que estos aprovechan la disposición en exceso de N para utilizarlo en procesos de degradación de polímeros orgánicos y transformación de nutrientes dejándolo disponible para procesos biológicos de otros organismos(25).
 
En el bloque 2 con tratamiento control se encontraron los géneros Clonostachys y Morlierella. Los miembros del género Clonostachys se desarrollan como mico parásito de otros hongos (26). A su vez son vulnerables a alteraciones en la mineralización proveniente de la fertilización del suelo, siendo considerados como bioindicadores de ecosistemas(27) . Lo anterior justifica que solo se haya podido aislar el género Clonostachys y Morlierella de las parcelas control. En el caso de Morlierella es un género que se encuentra ampliamente relacionado con la presencia de C, está involucrado en la degradación de la celulosa(28).
 
El género Morlierella no se encuentra presente en los bloques con tratamiento de N, debido a que en este caso el exceso de nitrógeno presente en los suelos estudiados disminuye la producción radical en las plantas. Como resultado que se reduzcan las asociaciones en planta y hongo, por lo tanto que disminuye su crecimiento (29).
 
Los resultados de este estudio nos permitieron identificar diversos géneros de hongos que se encuentran asociados a la respuesta por estrés a la adición continua de nitrógeno en los suelos de la RBSF.

 
CONCLUSIONES

 
-        El empleo de técnicas de cultivo in vitro de microorganismos es útil para la identificación de hongos con niveles variables de resistencia a N.
 
-        El diseño experimental seguido (segregación de parcelas control y con tratamiento) permitió identificar especies fúngicas con un grado diferente de tolerancia a la deposición de N.
 
-        Se concluyó que los géneros Metarrhzium y Tolypocladium presentes en este trabajo, se identifican como más resistentes a la elevación del nitrógeno. Se sugiere la utilización de los géneros antes mencionados en técnicas de inoculación, con la finalidad de ser aplicados en suelos perturbados por alta deposición de N.
 
-        Se sugiere el uso de miembros del género Clonostachys y Morlierella como bioindicadores del impacto de la fertilización nitrogenada en ecosistemas tropicales.
 
-        El porcentaje de reactivación de las cepas criopreservadas fue de 98%, lo que indica el éxito en la metodología de criopreservación que se empleó en los cultivos de hongos.

 
Agradecimientos

 
En el desarrollo de esta investigación y a su vez en la culminación de mi carrera universitaria, hago extenso mis agradecimientos al PhD. Aminael Sánchez Rodríguez, que gracias a su dirección hizo posible el desarrollo de este trabajo; aportando con sus conocimientos y experiencia.
 
Agradezco a mi colega Blgo. José Francisco Ochoa por su apoyo y aportes en la realización de este proyecto.
 
A mi madre y familiares por estar presentes a lo largo de mis estudios.

 
REFERENCIAS BIBLIOGRÁFICAS
 
1.        Cuesta F, Peralvo M, Valarezo N. Los Bosques Montanos de los Andes Tropicales. 2009. p. 1–41.
 
2.        Torrachi S. Deforestación de Bosques Montanos y patrones de pérdidad de hábitats en la región sur del Ecuador. 2002; Available from: http://sig.utpl.edu.ec/sigutpl/staftpro/sig/paperambiental.PDF
 
3.        Baldos AP, Corre MD, Veldkamp E. Response of N cycling to nutrient inputs in forest soils across a 1000–3000 m elevation gradient in the Ecuadorian Andes. Ecology [Internet]. 2015;96(3):749–61. Available from: http://dx.doi.org/10.1890/14-0295.1
 
4.        Montaño NM, Sandoval AL. Contaminanción Atmosferica y salud. 2007;29–33.
 
5.        Müller AK, Matson AL, Corre MD, Veldkamp E. Soil N2O fluxes along an elevation gradient of tropical montane forests under experimental nitrogen and phosphorus addition. Front Earth Sci [Internet]. 2015;3(October):1–12. Available from: http://journal.frontiersin.org/Article/10.3389/feart.2015.00066/abstract
 
6.        Craine JM, Brookshire ENJ, Cramer MD, Hasselquist NJ, Koba K, Marin-Spiotta E, et al. Ecological interpretations of nitrogen isotope ratios of terrestrial plants and soils. Plant Soil. 2015;396(1–2):1–26.
 
7.        Castellanos O, Melissa D, Zabala B, Beatriz L, Botía R, Mauricio D, et al. caracterización de bacterias diazotróficas asimbióticas asociadas al eucalipto (eUCALYPTUSSP.) en codazzi, cesar (colombia). Acta Biológica Colomb. 2010;15(3):1–7.
 
8.        Alvarez S. La descomposición de materia orgánica en humedales : la importancia del componente microbiano . Ecosistemas. 2005;14(2):17–29.
 
9.        Ramírez AB. Estudio de la biodiversidad fúngica en el suelo del viñedo de la Finca La Grajera. Univerdad la Rioja. 2014;
 
10.      P. Paladines RL. Fundación Científica San Francisco. Fund Científica San Fr. 2003;5(2):139–41.
 
11.      Parra S. Universidad del Azuay Facultad de Ciencia y Tecnología Autor Silvia Patricia Parra Suárez Danilo Minga Ochoa. 2011;4.
 
12.      Saltos N. Extracción de ADN genómico y amplificación de la región ITS por PCR en el ascomicete marino Lulwarthia grandispora. 2012;91.
 
13.      Medina M, Weil E, Szmant AM. Examination of the Montastraea annularis Species Complex (Cnidaria: Scleractinia) Using ITS and COI Sequences. Mar Biotechnol. 1999;1(1):89–97.
 
14.      Ramos Zapata JA. Capítulo III. Los organismos. Microorganismos del Suelo. Available from: http://www2.inecc.gob.mx/publicaciones/libros/429/organismos.pdf
 
15.      Ávila-Portillo LM, Madero JI, López C. Fundamentos De Criopreservación. Rev Colomb Obstet Ginecol. 2006;57(4):291–300.
 
16.      Gutiérrez YAP. Evaluación de métodos para la conservación de hongos fitopatógenos del ñame (Dioscorea sp). Rev Colomb Biotecnol. 2009;11(2):8–18.
 
17.      Pernía B, Demey JR, Ysvic Inojosa, Naranjo-Briceño L. Biodiversidad y potencial hidrocarbonoclastico de hongos aislados de crudo y sus derivados: Un meta-análisis. 2012;(July 2015).
 
18.      Snellman EA, Collins RP, Cooke JC. Utilization of fuel oils by fungi isolated from oceanic tar balls. Lett Appl Microbiol. 1988;6(5):105–7.
 
19.      Arias E, Piñeros P. Aislamiento e identificación de hongos filamentosos de muestras de suelo de los páramos de Guasca y Cruz Verde. PhD Propos. 2008;1.
 
20.      Jos E, Posso S. Evaluación de la producción de ácidos orgánicos en microorganismos rizosféricos y sus efectos en la solubilización de fosfatos. 2015;
 
21.      Hernández SD. “Estudio transcriptómico de la interacción Trichoderma-tomate. Expresión del gen amdS de Aspergillus nidulans en Trichoderma harzianum y su papel en el metabolismo del nitrógeno y la respuesta de defensa de la planta.” Cult la seducción [Internet]. 2014; Available from: http://books.google.com/books?hl=en&lr=&id=h6y6BAAAQBAJ&oi=fnd&pg=PA11&dq=Universidad+de+salamanca&ots=6M7IkfNK_3&sig=YLozhRFcnOEw1w7tkrtoVBW4lnI
 
22.      Gutierrez A, Saldarriaga Y. Observacion de la patogenicidad de Metarhizium anisopliae en soldados Nasutitermes sp. (Isoptera Termitidae). 2004. p. 6.
 
23.      Mascarin GM, Kobori NN, de Jesus Vital RC, Jackson MA, Quintela ED. Production of microsclerotia by Brazilian strains of Metarhizium spp. using submerged liquid culture fermentation. World J Microbiol Biotechnol. 2014;30(5):1583–90.
 
24.      Hermosín B, Nováková A, Jurado V, Láiz L, Porca E, Rogelio MA. Observatorio microbiológico de cuevas : evaluación y control de comunidades fúngicas en cuevas sometidas al impacto de actividades turísticas Caves microbial observatory : assessment and control of fungal communities in show caves. 2010;513–20.
 
25.      Allison SD, Czimczik CI, Treseder KK. Microbial activity and soil respiration under nitrogen addition in Alaskan boreal forest. Glob Chang Biol. 2008;14(5):1156–68.
 
26.      Rolando Hermes Cerda Bustillos, Soto G. Calidad de suelos en plantaciones de cacao (Theobroma cacao), banano (Musa AAA) y plátano (Musa AAB) en el valle de Talamanca, Costa Rica. 2008;Maestría e:66.
 
27.      Moratto C, Martínez LJ, Valencia H, Sánchez J. The effect of land use on phosphate solubilising fungi and diazotrophic bacteria on the bleak uplands of páramo of Guerrero, Cundinamarca department. Agron Colomb [Internet]. 2005;23(2):299–309. Available from: http://www.scielo.org.co/scielo.php?script=sci_arttext&pid=S0120-99652005000200015&lng=en&nrm=iso&tlng=es
 
28.      ortiz c, rubio a, benito m. Influencia de la composición vegetal en la actividad microbiana del suelo en el límite de árbol en el sistema central. Statew Agric L Use Baseline 2015. 2015;1:1–12.
 
29.      Salinas C uriel flores. Evaluación de la Tasa de Crecimiento de Phytophthora cinnamoni Rands en Medios Alternativos. 2015;
 
30.     MO BIO Laboratories, Inc, 2017. Isolate high quality DNA from microbial cultures. [online] Available at: https://mobio.com/products/dna-isolation/microbial/ultracleanr-microbial-dna-isolation-kit.html [Accessed 28 Sep. 2016].
 
31.      Lynch J. M. y Hobie J.E. 1983. Microorganisms in action: concepts and applications in Microbial ecology. Blackwell Scientific Publications, Gran Bretaña.
 
 
Recibido : 30 mayo 2017
Aprobado: 20 junio 2017
 
 
Xiomara Recalde Rodriguez1   Aminael Sanchez Rodríguez2
 
1Departamento de Ciencias Biológicas. Universidad Técnica Particular de Loja. Ecuador
 
2MS2E Microbial Systems Ecology and Evolution / Ecología y Evolución de Sistemas Microbianos. Departamento de Ciencias Biológicas. Universidad Técnica Particular de Loja. Ecuador
 
 
Autor de correspondencia: Xiomy Recalde Rodríguez:  xiomysr14@hotmail.com
 
 
 
Back to content | Back to main menu